The total RNAs were quantified by ultraviolet spectrophotometer at 260 nm. miRNA microarray hybridization Total 33 miRNA microarrays were used to examine miRNA expression profiling. 3 miRNA microarrays were used for 3 normal gastric tissues, 24 miRNA microarrays were used for 24 malignant tissues, and 6 for SGC7901 and GES-1 cell lines. 5 μg total RNAs from each sample were used for miRNA labeling. Then, miRNA array hybridizations were performed on miRNA microarray. A GenePix 4000B scanner (Axon Instruments) was employed to detect hybridization

signals via streptavidin-Alexa Fluor 647 conjugation. Images were quantified by the GenePix Pro 6.0(Axon Instruments). Reverse transcription The total Anlotinib solubility dmso RNAs were reverse learn more transcribed to synthesize cDNA. The RT Primers were designed by Primer 5.0 software and shown in Table 1. The 20 μl reaction system included 2 μl dNTPs (HyTest Ltd), 2 μl 10× RT Buffer (Epicentre), 1 μl RTspecific primer, 1 μg Total RNA, 2 μl M-MLV reverse transcriptase

(Epicentre), 0.3 μl RNase inhibitor (Epicentre) and nucleas-free ddH2O. The reaction was performed at 16°C for 30 min, 42°C for 42 min followed by 85°C for 5 min. The process was performed in Gene Amp PCR System 9700 (Applied Biosystems). The reverse transcription products were stored at -20°C for use. Table 1 Reverse transcription primers Gene name RT primer U6 5′CGTTCACGAATTTGCGTGTCAT3′ hsa-miR-9 5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATACAG3′

hsa-miR-433 5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCACACCG3′ Quantitative Real-time PCR The expressions of miR-9 and miR-433 in 29 samples were identified by qRT-PCR. The interested miRNAs and an interior reference U6 were run in Rotor-Gene 3000 Real-time PCR (Corbett Research). GNA12 Real-time PCR primers were shown in Table 2. 25 μl PCR mixture included 2.5 μl dNTPs (HyTest Ltd), 2.5 μl 10 × PCR Buffer (Promega), 1.5 μl MgCl2 liquor (Promega), 1 unit Taq polymerase (Promega), SybergreenI (Invitrogen) final concentration 0.25×, 1 μl PCR specific primer forward and reverse, 1 μl reverse transcription product and nucleas-free water. The reactions were performed at 95°C for 5 min, then followed by 40 cycles of 95°C for 10 s and 60°C for 1 min. The expression of miRNA was measured by Ct(threshold cycle). The Ct represented the Cediranib solubility dmso fractional cycle number when the fluorescence of each sample passed the fixed threshold. The ΔΔCt method determined miRNA expression level. The change was generated using the equation: 2-ΔΔCT.